coli-S. aureus shuttle cloning vector, Apr Cmr Addgene pLIluxS pLI50 with luxS and its promoter, Apr Cmr 60 pgfp gfp expression with the promoter of S10 ribosomal gene, selleckchem Apr, Cmr a NARSA, Network on Antimicrobial Resistance in Staphylococcus aureus. Construction of bacterial strains To construct the ΔluxS strain from S. aureus SGC-CBP30 mouse RN6390B and the Δagr ΔluxS strain from S. aureus RN6911, the purified pBTluxS plasmid was used for allele replacement by erythromycin-resistance gene insertional mutagenesis as described
previously [45]. Briefly, the appropriate upstream and downstream fragments of luxS were amplified from the genome of RN6390B, and the erythromycin-resistance gene was amplified from pEC1 with the relevant primers. The three fragments were ligated with each other with the erythromycin-resistance gene in the middle, and then ligated with the temperature-sensitive shuttle vector pBT2. The resulting plasmid pBTluxS [43] was introduced by electroporation into S. aureus strain RN4220 for propagation, and then transformed into S. aureus RN6390B
for luxS mutation and S. aureus RN6911 for agr luxS double-gene mutation. All primers used in this study are listed in Table 2. Table 2 Oligonucleotide primers used in this study Primer Sequence rt-16S-f CGTGGAGGGTCATTGGA rt-16S-r CGTTTACGGCGTGGACTA rt-icaA-f TTTCGGGTGTCTTCACTCTAT rt-icaA-r CGTAGTAATACTTCGTGTCCC rt-icaR-f ATCTAATACGCCTGAGGA rt-icaR-r TTCTTCCACTGCTCCAA rt-clfB-f TTTGGGATAGGCAATCATCA rt-clfB-r TCATTTGTTGAAGCTGGCTC rt-fnbA-f ATGATCGTTGTTGGGATG rt-fnbA-r GCAGTTTGTGGTGCTTGT rt-fnbB-f Torin 1 research buy ACAAGTAATGGTGGGTAC rt-fnbB-r AATAAGGATAGTATGGGT rt-map-f AAACTACCGGCAACTCAA rt-map-r TGTTACACCGCGTTCATC rt-efb-f TAACATTAGCGGCAATAG rt-efb-r CCATATTCGAATGTACCA To make the luxS-complemented Thiamet G strain, the pLIluxS plasmid, which contains the native promoter of luxS and its intact open reading frame, was constructed in our previous work [43]. We purified the pLIluxS plasmid
and transformed it into the ΔluxS strain for complementation, thus constructing the ΔluxSpluxS strain. WT and ΔluxS strains were also transformed with the empty plasmid pLI50 constructing strains WTp and ΔluxSp, which were used as the control. These strains transformed with plasmid were cultured in medium with chloramphenicol (15 μg/ml). The AI-2 precursor molecule, DPD, of which the storage concentration is 3.9 mM dissolved in water, was purchased from Omm Scientific Inc., TX, USA. Biofilm formation and analysis Biofilm formation under static conditions was determined by the microtitre plate assay based on the method described previously [46]. Briefly, the overnight cultures were made at a 1:100 dilution using fresh TSBg. The diluted cell suspension was inoculated into flat-bottom 24-well polystyrene plates (Costar 3599, Corning Inc., Corning, NY), 1 ml for each well.