BRD4 induces osteogenic differentiation of BMSCs via the Wnt/β-catenin
signaling pathway
Kai Wang a,1
, Zhiping Zhao b,1
, Xiangyu Wang b
, Yongtao Zhang b,
a Arthritis Clinic and Research Centre, Peking University People’s Hospital, Beijing, 100044, China b Department of Joint Surgery, The Affiliated Hospital of Qingdao University, Qingdao, 266000, Shandong, China
ARTICLE INFO
Keywords:
BRD4
Epigenetic regulation
JQ1
Mineralization
Osteogenic differentiation
Wnt/β-catenin signaling pathway
ABSTRACT
Bromodomain 4 (BRD4), an important epigenetic regulator, is involved in many bone-related pathologies via
promoting osteoclast formation. However, whether and how it participates in the process of osteoblast formation
remain unclear. This study aimed to investigate the potential role of BRD4 in osteogenic differentiation of bone
marrow stromal cells (BMSCs). Our experiments revealed that an inhibitor of BRD4, JQ1, attenuated osteogenic
differentiation of BMSCs. The recombinant adenoviruses for AdBRD4 and AdsiBRD4 could infect BMSCs with
high efficiency. Exogenous BRD4 expression potentiated differentiation, and silencing endogenous BRD4
expression decreased it. In addition, the Wnt/β-catenin signaling pathway is known to be important for osteo￾genic differentiation. Our results showed that AdBRD4 increased the expressions of Wnt3a and β-catenin while
AdsiBRD4 decreased the expressions. What’s more, the recombinant adenovirus for Adsiβ-catenin, which obvi￾ously decreased in β-catenin expression, inhibited BRD4-induced osteogenic differentiation. Conclusion: Our data
indicates that the epigenetic reader BRD4 participates in the process of BMSC osteogenic differentiation via the
Wnt/β-catenin signaling pathway. This finding may pave the way into further understanding the mechanism of
BMSC osteogenic differentiation.
1. Introduction
Human bones are the only tissue that can be continually remodeled
over the whole life, and the equilibrium between bone formation by
osteoblasts and bone resorption by osteoclasts is vital to the mainte￾nance of bone integrity(Lin et al., 2020; Long et al., 2017). If newly
formed bone is less than that resorpted, many bone-related pathologies
would be caused, such as osteoporosis, osteonecrosis, and rheumatoid
arthritis(Wang et al., 2018; Yongtao et al., 2014; Zhang et al., 2014).
Decreased bone formation mainly results from reduced osteogenic dif￾ferentiation potential of bone marrow stromal cells (BMSCs), especially
in bone-related pathologies(Mostafa et al., 2019; Wang et al., 2014).
BMSCs are characterized by their differentiation into multiple types of
cells in different microenvironments (Chen et al., 2020, 2019). Insuffi￾cient osteogenic differentiation of BMSCs will induce decrease of bone
formation. Hence, it is vital to identify factors regulating BMSC
osteogenic differentiation.
Differentiation of BMSCs into mature osteoblasts is tightly regulated
by gene expressions, in which epigenetic regulation, including non￾coding RNAs, DNA methylation, and posttranslational modifications to
histone tails, plays an important role(Liu et al., 2016; Paradise et al.,
2020). Bromodomain (BRD) and extra-terminal domain (BET) proteins
(BRD2, BRD3, BRD4, and BRDt) are a family of epigenetic regulators.
Among these proteins, BRD4, which is well studied, is characterized by
two tandem bromodomains (BD1, BD2). BD1 and BD2 bind acetylated
lysine residues on target proteins, including histones. Therefore, BRD4
interacts with hyper-acetylated histone regions along the chromatin,
accumulating on transcriptionally active regulatory elements and pro￾moting gene transcription at both initiation and elongation steps (Liang
et al., 2020; Ren et al., 2019; Taniguchi, 2016). BRD4 is also known to be
involved in many bone-related pathologies (Baud’huin et al., 2017;
Deepak et al., 2017; Guo et al., 2019; Jacques et al., 2020; Meier et al.,
Abbreviations: ALP, Alkaline phosphatase; BET, Bromodomain and extra-terminal domain; BMSCs, bone marrow stromal cells; BRD, Bromodomain; Col1a1,
collagen1a1; BMP9, bone morphogenetic protein 9; LRP5/6, low density lipoprotein-related receptors 5 and 6; PCR, polymerase chain reaction; PVDF, polyvinylidene
fluoride; Runx2, runt-related transcription factor 2; TCF/LEF, T-cell factor/lymphocyte.
* Corresponding author at: Department of Orthopedics, the Affiliated Hospital of Qingdao University, Qingdao, 266061, Shandong, China.
E-mail address: [email protected] (Y. Zhang). 1 These authors contributed equally to this paper.
Contents lists available at ScienceDirect
Tissue and Cell
journal homepage: www.elsevier.com/locate/tice

https://doi.org/10.1016/j.tice.2021.101555

Received 1 November 2020; Received in revised form 22 March 2021; Accepted 28 April 2021
Tissue and Cell 72 (2021) 101555
2017; Meng et al., 2014). The other studies also found that Brd4 is
required for osteoblast differentiation in vitro (Baud’huin et al., 2017;
Najafova et al., 2017; Paradise et al., 2020). However, the precise
mechanism is not clear. Therefore, it is necessary to clarify the mecha￾nism of BRD4 in osteoblast differentiation.
Many signaling pathways have been proven to regulate osteogenic
differentiation of BMSCs(Lowery and Rosen, 2018; Luo et al., 2019).
Among them, the canonical Wnt/β-catenin signaling pathway plays an
important role in promoting osteogenesis (Shares et al., 2018; Tang
et al., 2009; Zhang et al., 2015). In this pathway, Wnts, a family of
secreted proteins, bind to their receptor complex consisted of the Friz￾zled (Fz) family receptor proteins and the low density
lipoprotein-related receptors 5 and 6 (LRP5/6), and prevent the degra￾dation of unphosphorylated β-catenin. Then, β-catenin accumulates in
cytoplasm and translocates into the nucleus. Upon entering the nucleus,
β-catenin interacts with the T-cell factor/lymphocyte enhancer factor
(TCF/LEF) transcription factors to activate target gene transcription and
expression (Maeda et al., 2019). Recent studies have shown that
osteogenesis mediated by many factors are fulfilled through the ca￾nonical Wnt/β-catenin signaling pathway (Hu et al., 2019; Tang et al.,
2009). For example, Hu et al. found that miR-26b promoted osteo￾genesis of BMSCs by directly activating the Wnt/β-catenin signaling
pathway (Hu et al., 2019). Tang et al. reported that the pathway,
possibly through the interaction between β-catenin and runt-related
transcription factor 2 (Runx2), plays an important role in bone
morphogenetic protein 9 (BMP9)-induced osteogenic differentiation of
BMSCs (Tang et al., 2009).
As suggested by previous studies, there exists an interaction between
BRD4 and the Wnt/β-catenin signaling pathway (Alghamdi et al., 2016;
Wang et al., 2020). For instance, Alghamdi et al. demonstrated that JQ1,
an inhibitor of BRD4, limited the self-renewal of MSCs by down regu￾lating the expression of Wnts (Alghamdi et al., 2016). Wang et al. found
that BRD4 promoted glioma cell stemness via enhancing
miR-142− 5p-mediated activation of the Wnt/β-catenin signaling
pathway (Wang et al., 2020). However, it remains unclear whether
BRD4 interacts with the Wnt/β-catenin signaling pathway in the process
of BMSC osteogenic differentiation. In the present study, we employed
mouse BMSCs to investigate whether BRD4 participated in the osteo￾genic differentiation of the cells and what role the Wnt/β-catenin
signaling pathway played in this process.
2. Materials and methods
2.1. Cell culture and treatment
HEK-293 cells were purchased from American Type Culture Collec￾tion (Manassas, Virginia, USA). Mouse BMSCs were isolated and
cultured as described previously (Zhang et al., 2020a), and the experi￾mental protocols were approved by the Institutional Animal Care and
Use Committee of the Affiliated Hospital of Qingdao University. Briefly,
mice were euthanized and their hind limbs were aseptically removed
immediately after sacrifice. The soft tissues and the ends of hind limbs
were removed. Marrow tissues of both the femur and the tibia were
flushed with DMEM (Gibco, USA) containing 20 % fetal bovine serum
(FBS, Gibco, USA), 1% penicillin, and streptomycin (Gibco, USA). A
single cell suspension was obtained and seeded in 10 cm tissue culture
dishes, and was incubated at 37 ◦C in 5% CO2 and 95 % humidity as
described previously (Ren et al., 2019; Zhang et al., 2020b). The
non-adherent cells were removed when the medium was changed every
3 days. The adherent cells were cultured until 70–80 % confluence and
were then passaged. Cells from passages 3–5 were used in subsequent
experiments. The obtained BMSCs and HEK-293 cells were cultured in
DMEM containing 10 % FBS together with 1 % streptomycin and peni￾cillin. JQ1 (Selleck Chemicals, USA), a BRD4 inhibitor and IWP-2 (5 μM,
Beyotime, China), a Wnt inhibitor, were dissolved in DMSO and added
to the culture medium at indicated time points. Control groups were
added with DMSO.
2.2. Osteogenic differentiation in vitro
For osteogenesis examination, BMSCs were placed in 24-well plates
at 5 × 104 cell density and cultured overnight in standard DMEM alpha
medium (Gibco, USA) supplemented with 10 % FBS (Gibco, USA) plus
1% streptomycin and penicillin (Gibco, USA). Then, the medium was
replaced with osteogenic base medium containing 100 nM dexametha￾sone (Sigma, USA), 10 mM β-glycerophosphate (Sigma, USA), and 50 μM
ascorbic acid (Sigma, USA), and was changed every 3 days.
2.3. Construction and amplification of recombinant adenoviruses
expressing BRD4, siBRD4, and siβ-catenin
The AdEasy system was used to construct and amplify recombinant
adenoviruses as described in previous studies(He et al., 1998; Zhang
et al., 2020a). Briefly, the coding region of mouse BRD4 was PCR
amplified and cloned into an adenoviral shuttle vector. For constructing
adenoviruses expressing siBRD4 and siβ-catenin, three siRNAs targeting
the coding region of mouse BRD4 and β-catenin were simultaneously
assembled to an adenoviral shuttle vector. HEK293 cells were used to
generate and amplify recombinant adenoviruses AdBRD4, AdsiBRD4
and Adsiβ-catenin. AdBRD4 also expresses GFP, while AdsiBRD4 and
Adsiβ-catenin also express RFP. An analogous adenovirus expressing
GFP (AdGFP) was used as control. Polybrene (4 μg/mL) was used to
increase adenovirus infection efficiency.
2.4. Cell counting Kit-8 (CCK8) assay
BMSCs (2500 cells/well) were cultured in 96-well plates overnight
and then treated with DMSO or different concentrations of JQ1 for day
1, 2, 3 and 6. The effect of JQ1 on cell viability was examined using CCK-
8 solution (Dojindo Laboratories, China) and the absorbance was
measured at 450 nm.
2.5. Real-time polymerase chain reaction (PCR)
Total RNA was extracted from cultured BMSCs under different
treatment conditions by TRIzol reagent (Invitrogen, Carlsbad, USA), and
was then reverse transcribed into cDNA using the Revert Aid First Strand
cDNA Synthesis kit (Fermentas, Canada) according to the normal pro￾tocol. The obtained cDNA was diluted and used as PCR templates. The
mRNA levels of target genes were detected using the SYBR Green PCR
master mix (TaKaRa, Japan). The relative expression of the target genes
was normalized to the expression of GAPDH (housekeeping gene) and
analyzed by the 2− ΔΔCt method. The sequences of primers were designed
using Primer3 Plus and are provided in Table 1.
Table 1
Primers sequences for reverse transcription-quantitative polymerase chain
reaction.
Target Primer sequence (5′
‑3′
) GenBank no.
BRD4 F: GGAGGAAAGAAACAGGGGCA NM_020508.4
R: AGCAGGAAAGGGGTGAGTTG
OCN F: CCAAGCAGGAGGGCAATA NM_001032298.3
R: TCGTCACAAGCAGGGTCA
Col1a1 F: GAGCGGAGAGTACTGGATCG NM_007742.4
R: GCTTCTTTTCCTTGGGGTTC
Runx2 F: CCGGTCTCCTTCCAGGAT NM_001271630.1
R: GGGAACTGCTGTGGCTTC
Wnt 3a F: GCCTCGGAGATGGTGGTA NM_009522.2
R: TTGGGTGAGGCCTCGTAG
β-Catenin F: GGTCCGAGCTGCCATGTT NM_001165902.1
R: TGGCAAGTTCCGCGTCAT
GAPDH F: GAGAGAGGCCCAGCTACTCG NM_008084.3
R: GAGGGCTGCAGTCCGTATTTA
K. Wang et al.
Tissue and Cell 72 (2021) 101555
2.6. Western blot
After the above treatment, BMSCs were harvested and lysed in RIPA
buffer (Beyotime, China) on ice, and the products were centrifuged at
10,000 × g for 10 min at 4 ◦C. The concentrations of total protein in cell
lysates were quantitated by using protein assay reagent (Beyotime,
China). The protein was denatured at 95 ℃ for 5 min in loading buffer,
loaded on SDS poly acrylamide gels (15 μl/lane), and then transferred
onto polyvinylidene fluoride (PVDF) membranes. The membranes were
then blocked with 5% fat-free milk for 2 h and incubated with rabbit
polyclonal antibody anti-mouse Wnt 3a (Cell Signaling Technology,
USA, 1:1000), rabbit monoclonal antibody anti-mouse β-catenin (Cell
Signaling Technology, USA, 1:1000), and rabbit monoclonal antibody
anti-mouse GAPDH (Cell Signaling Technology, USA, 1:2000) overnight
at 4 ℃, respectively. The blots were detected with HRP-linked antibody
(Cell Signaling Technology, USA, 1:5000), and visualized using ECL-Plus
reagent. The intensity of staining was scanned and analyzed using Image
Pro Plus 6.0.
2.7. Alkaline phosphatase (ALP) activity assay
ALP activity was assessed by colorimetric assay as described previ￾ously (Zhang et al., 2020a). Briefly, BMSCs were treated under
appointed conditions for 3 and 6 days, respectively. The cells were lysed
with luciferase cell lysis buffer (Promega, USA), and the products were
centrifuged at 12,000 × g for 10 min at 4 ◦C. Then, 5 μl sample lysate
was mixed with 5 μl ALP substrate (BD Biosciences Clontech, USA) and
15 μl LUPO buffer containning 10 mM diethanolamine, 0.5 mM MgCl2
and 10 mM L-homoarginine. The mixture was incubated at room tem￾perature for 30 min, after which the ALP activity was read by following
the luciferase assay procedure.
2.8. ALP staining
BMSCs were seeded in 24-well plates and treated under appointed
conditions. After osteogenic induction for 7 days, the cells were rinsed
carefully with deionized water for 1 min. Then, the cells were incubated
with alkaline-dye mixture (Sigma-Aldrich, USA) at room temperature
for 30 min under shading condition. Finally, microscopic images were
obtained.
2.9. Alizarin red staining
BMSCs were seeded in 24-well plates, treated under appointed con￾ditions, and osteogenic differentiated in osteogenic base medium for 14
days. The cells were then stained with alizarin red (Sigma, USA) at room
temperature for 2 min, after which microscopic images were obtained
and calcium nodules were detected as red bodies. For quantitative as￾says, alizarin red was extracted using 10 % acetic acid (Sigma, USA) and
its optical density was measured at 405 nm.
2.10. Statistical analysis
Statistical analyses were performed using SPSS 17.0 (SPSS Inc.,
Chicago, IL, USA). Data are expressed as the mean ± standard deviation
(SD). Differences among groups were analyzed using Kruskal–Wallis
test, one-way analysis of variance test or t test; subgroup analysis was
performed using the LSD test. A value of p < 0.05 was considered sta￾tistically significant for all analyses.
3. Results
3.1. BRD4 inhibition attenuated osteogenic differentiation of BMSCs
To investigate the possible role of BRD4 in the process of osteogenic
differentiation of BMSCs, the cells were treated with or without JQ1 at
various concentrations (50, 100 and 200 nM). Cell viability was deter￾mined by CCK8 assay, which showed no significant difference in cell
viability between the vehicle treatment and JQ1 treatment at days 1, 2, 3
and 6 (Fig. 1A). Detection of ALP, the marker of early osteogenesis,
demonstrated that JQ1 reduced ALP activity in a dose-dependent
manner at both day 3 and day 6 after stimulation (Fig. 1B). A similar
pattern for ALP staining was detected in BMSCs under different treat￾ment conditions at day 7 after stimulation (Fig. 1C).
Mineralization of the extracellular matrix is another key marker of
BMSC differentiation into osteoblasts. The level of matrix mineralization
was evaluated by alizarin red staining when the cells were cultured in
osteogenic medium. Less matrix mineralization was visually seen under
microscope in the JQ1 treatment groups than in the control group at day
14 (Fig. 1D). The quantity of mineralization decreased significantly in a
dose-dependent manner (Fig. 1E).
The effects of JQ1 on the osteogenic markers, such as osteocalcin
(OCN) and collagenlal (Collal), were analyzed subsequently. It was
found that JQ1 decreased the mRNA levels of OCN and Collal in a dose￾dependent manner at day 5 after stimulation (Fig. 1F). Furthermore,
osteogenic regulator runt-related transcription factor 2 (Runx2) was also
significantly inhibited by JQ1 in the similar way (Fig. 1F). These results
suggested the involvement of BRD4 in the process of BMSC osteogenic
differentiation.
3.2. Exogenous BRD4 expression potentiated BMSC osteogenic
differentiation and silencing endogenous BRD4 expression decreased the
differentiation
The role of BRD4 in BMSC osteogenic differentiation was further
investigated by using the recombinant adenoviruses for AdBRD4 and
AdsiBRD4, both of which can infect BMSCs with high efficiency
(Fig. 2A). The AdsiBRD4-infected BMSCs exhibited obvious decrease in
BRD4 expression as compared with that of the AdGFP-infected cells
(Fig. 2B). ALP activity assay demonstrated that AdBRD4 increased ALP
activity while AdsiBRD4 decreased ALP activity, as compared with that
in the GFP group, at both day 3 and day 6 (Fig. 2C). A similar pattern for
ALP staining was detected in BMSCs under different treatment condi￾tions at day 7 (Fig. 1D).
As demonstrated by alizarin red staining, a higher level of matrix
mineralization was visually seen under microscope in AdBRD4-infected
BMSCs than in the control group at day 14; in contrast, a lower level of
mineralization was seen in cells treated with AdsiBRD4 (Fig. 2E). The
quantity of mineralization also showed a similar pattern among the
three groups (Fig. 2F). In addition, the mRNA levels of OCN, Collal and
Runx2 increased in cells treated with AdBRD4 as compared with those
treated with AdGFP at day 5, while the level of Collal decreased in cells
treated with AdsiBRD4 (Fig. 2G). These results further proved that BRD4
participated in the process of BMSC osteogenic differentiation.
3.3. BRD4 partipated in the activation of Wnt/β-catenin signaling
pathway
BMSCs were infected with AdBRD4, AdsiBRD4, and AdGFP, respec￾tively, and expressions of Wnt3a and β-catenin were determined. The
results showed that, as compared with in the GFP group, AdBRD4
increased the Wnt3a and β-catenin protein levels while AdsiBRD4
decreased the levels (Fig. 3A). A similar pattern of the mRNA levels of
Wnt3a and β-catenin was also detected (Fig. 3B). These results suggested
an invovlement of BRD4 in the activation of Wnt/β-catenin signaling
pathway.
3.4. Wnt/β-catenin signaling pathway was involved in BRD4-induced
osteogenic differentiation of BMSCs
Recombinant adenoviruses for Adsiβ-catenin were used to further
investigate the involvment of Wnt/β-catenin signaling pathway in
K. Wang et al.
Tissue and Cell 72 (2021) 101555
BRD4-induced osteogenic differentiation. Adsiβ-catenin infected BMSCs
with high efficiency (Fig. 4A). Adsiβ-catenin and AdBRD4 co-infected
BMSCs exhibited obvious decrease in β-catenin expression when
compared with that of the GFP group (Fig. 4B). ALP activity assay
demonstrated lower ALP activity in cells co-infected with Adsiβ-catenin
and AdBRD4 than in cells infected with AdBRD4 alone at both day 3 and
day 6 after stimulation (Fig. 4C). A similar pattern for ALP staining was
detected in cells under different treatment conditions at day 7 (Fig. 4D).
Alizarin red staining showed that less matrix mineralization was visually
seen at day 14 in cells co-treated with AdBRD4 and Adsiβ-catenin than in
those treated with AdBRD4 (Fig. 4E). The quantity of mineralization,
again, displayed the similar pattern among the three groups (Fig. 4F).
Furthermore, the mRNA levels of OCN, Collal and Runx2 were lower in
cells co-infected with Adsiβ-catenin and AdBRD4 than in cells infected
with AdBRD4 when observed at day 5 (Fig. 4G).
Next, a Wnt inhibitor, IWP-2, was also used to investigate the
involvement of Wnt/β-catenin signaling pathway in BRD4-induced
osteogenic differentiation. The results showed lower ALP staining and
ALP activity in cells co-treated with AdBRD4 and IWP-2 than in cells
infected with AdBRD4 alone (Fig. 5A and B). Alizarin red staining
revealed less matrix mineralization at day 14 in the co-treated cells
(Fig. 5C and D). Furthermore, the mRNA levels of OCN, Collal and
Runx2 were lower in the co-treated cells than in cells infected with
AdBRD4 alone when observed at day 5 (Fig. 5E). These results further
proved the involvement of the Wnt/β-catenin signaling pathway in
BRD4-induced osteogenic differentiation of BMSCs
4. Discussion
The present study investigated the effect of BRD4 on osteogenesis of
BMSCs which play a central role in bone formation(Chen et al., 2020;
Mostafa et al., 2019). Our experimental results demonstrated that BRD4
participated in the process of BMSC osteogenic differentiation via the
Wnt/β-catenin singling pathway.
Recently, a number of studies have been conducted exploring the
role of BRD4 in bone-related pathologies(Baud’huin et al., 2017; Guo
et al., 2019; Jacques et al., 2020; Meng et al., 2014). Our previous
studysuggested that BRD4 might participate in periprosthetic osteolysis
by promoting bone resorption mediated by inflammatory cytokines (Ren
et al., 2019). Meng et al. demonstrated that alveolar bone loss was
alleviated in JQ1-treated mice because JQ1 reduced osteoclasts forma￾tion by neutralizing BRD4 enrichment at several gene promoter regions
(Meng et al., 2014). An in vivo study also reported that the pharmaco￾logical BRD4 inhibitor JQ1 alleviated pathologic bone loss in ovariec￾tomized C57BL/6 female mice by increasing the trabecular bone volume
and restoring mechanical properties (Baud’huin et al., 2017).
Fig. 1. JQ1 inhibited osteogenic differentiation
of BMSCs. BMSCs were cultured in osteogenic
medium without or with JQ1 at various con￾centrations (50 nM – 200 nM). A Cell viability
determined by CCK8 assay at at day 1, 2, 3 and 6
post-treatment. B ALP activity measured on days
3 and 6 of osteogenic differentiation. C Repre￾sentative images of ALP staining on day 7 of
osteogenic differentiation (magnifification x 40).
D Representative images of alizarin red staining
on day 14 of osteogenic differentiation (magni￾fification x 40). E Mineralization quantitated
from stained mineral deposits. F mRNA expres￾sion levels of osteogenic genes on day 5 of oste￾ogenic differentiation. Data are representative
images or expressed as the mean ± SD (n = 3
wells/treatment); *p < 0.05 vs. the control
group; **p < 0.01 vs. the control group.
K. Wang et al.
Tissue and Cell 72 (2021) 101555
However, these studies have mainly focused on osteoclast formation
and bone resorption. The present study, instead, addresses osteogensis.
Our results demonstrate that BRD4 participates in the process of oste￾ogenic differentiation of BMSCs, which supplements our understanding
of the mechanism of BRD4 participating in bone-related pathologies.
Moreover, our results are in agreement with the finding of Najafova
et al. that BRD4 is essential to osteoblast differentiation (Najafova et al.,
2017).
Although JQ1 can weaken the role of BRD2, BRD3 and BRD4, its
higher affinity for BRD4 makes it a main inhibitor of BRD4 (Baud’huin
et al., 2017). Owing to this, JQ1 was adopted in this study. Our results
showed that JQ1 inhibited BMSC osteogenic differentiation in a
dose-dependent manner, which hinted a role of BRD4 in osteogenesis of
BMSCs. This finding is similar to those in some exisiting studies, which
reported that JQ1 treatment prevented osteogenesis of MC3T3 cells and
Human MSCs (Baud’huin et al., 2017; Paradise et al., 2020). Since JQ1
can also weaken the role of BRD2 and BRD3, recombinant adenoviruses
for BRD4 were used to clarify the potential role of BRD4 in BMSC
osteogenic differentiation. Our results indicated that the AdBRD4
treatment resulted in overexpression of BRD4, which promoted BMSC
Fig. 2. Exogenous BRD4 expression potentiated
BMSC osteogenic differentiation and silencing
endogenous BRD4 expression decreased the
differentiation. BMSCs were infected with
AdGFP, AdBRD4 or AdsiBRD4. A Representa￾tive images of fluorescent signals at 48 h post
infection (magnifification x 100). B BRD4
mRNA expression levels at 48 h post infection.
C Representative images of ALP staining on day
7 of osteogenic differentiation (magnifification
x 40). D ALP activity on days 3 and 6 of oste￾ogenic differentiation. E Representative images
of alizarin red staining on day 14 of osteogenic
differentiation (magnifification x 40). F Miner￾alization quantitated from stained mineral de￾posits. G mRNA expression levels of osteogenic
genes on day 5 of osteogenic differentiation.
Data are representative images or expressed as
the mean ± SD (n = 3 wells/treatment); *p <
0.05 vs. the AdGFP group; **p < 0.01 vs. the
AdGFP group.
Fig. 3. BRD4 participated in the activation of Wnt/β-catenin singaling pathway. BMSCs were infected with AdGFP, AdBRD4 or AdsiBRD4. A The relative levels of
Wnt3a and β-catenin protein expressions on day 3 post infection. B mRNA expression levels of Wnt3a and β-catenin on day 3 post infection. Data are representative
images or expressed as the mean ± SD (n = 3 wells/treatment); *p < 0.05 vs. the AdGFP group.
K. Wang et al.
Tissue and Cell 72 (2021) 101555
osteogenesis, while the AdRsimBRD4 treatment caused low BRD4
expression, which reduced the osteogenesis. Similar results were also
obtained elsewhere, such as in Paradise et al., who reported that
knockdown of BRD4 with small interfering RNA impaired the osteogenic
differentiation of MC3T3 cells(Paradise et al., 2020). However, opposite
results were demonstrated by Baud’huin et al., in which knocking down
BRD4 by transduction of human MSCs with shBRD4 increased the
osteoblastic differentiation (Baud’huin et al., 2017). In this study, re￾combinant adenoviruses for BRD4, which have higher efficiency in
silencing BRD4, were used to clarify the essential role of BRD4 in BMSC
osteogenic differentiation.
Activation of canonical Wnt/β-catenin signaling pathway is a main
factor in the process of osteogenic differentiation of BMSCs (Shares
et al., 2018; Tang et al., 2009; Zhang et al., 2015). Increase in the ex￾pressions of Wnt3a and β-catenin, the two important components in the
pathway, signalizes the activation of the pathway(Maeda et al., 2019;
Park et al., 2019). In this study, the AdBRD4 treatment increased the
Wnt3a and β-catenin expressions, and inversely the AdsimBRD4 treat￾ment decreased the expressions. Our further examination using
Adsiβ-catenin and IWP-2, showed that the process of BRD4-induced
osteogenic differentiation was mitigated by Adsiβ-catenin and IWP-2.
These data suggested that BRD4-induced osteogenic differentiation of
Fig. 4. Silencing endogenous β-catenin expres￾sion significantly impacted BRD4-induced
osteogenic differentiation of BMSCs. BMSCs
were infected with AdGFP, AdBRD4 or Adsiβ-
catenin. A Representative images of fluorescent
signals at 48 h post infection (magnifification x
100). B mRNA expression levels of β-catenin at
48 h post infection. C ALP activity on days 3
and 6 of osteogenic differentiation. D Repre￾sentative images of ALP staining on day 7 of
osteogenic differentiation (magnifification x
40). E Representative images of alizarin red
staining on day 14 of osteogenic differentiation
(magnifification x 40). F Mineralization quan￾titated from stained mineral deposits. G mRNA
expression levels of osteogenic genes on day 5
of osteogenic differentiation. Data are repre￾sentative images or expressed as the mean ± SD
(n = 3 wells/treatment); *p < 0.05 vs. the
AdGFP group; **p < 0.01 vs. the AdGFP group;
##p < 0.01 vs. the AdBRD4 group.
K. Wang et al.
Tissue and Cell 72 (2021) 101555
BMSCs might be dependent on the activation of Wnt/β-catenin singling
pathway. Similarly, some other studies have also demonstrated the close
relationship between BRD4 and the Wnt/β-catenin singling pathway
(Alghamdi et al., 2016; Song et al., 2019; Wang et al., 2020). For
example, Alghamdi et al. (Alghamdi et al., 2016) found that knockdown
of BRD4 using lentivirus decreased the expressions of the main com￾ponents of the Wnt/β-catenin singling pathway.As we all known, BRD4
interacts with transcriptionally active regulatory elements and promotes
gene transcription and protein expressions (Song et al., 2019). There￾fore, BRD4 may bound to the Wnt3a or β-catenin promoters, and then
increase the expressions of Wnt3a and β-catenin in the process of oste￾ogenic differentiation of BMSCs, which deserves further research.
5. Conclusion
In conclusion, our data indicate that the epigenetic reader BRD4
participates in the process of BMSC osteogenic differentiation via the
canonical Wnt/β-catenin signaling pathway. The findings in this study
may provide insights into understanding the mechanism of BMSC oste￾ogenic differentiation, which may in turn facilitate the development of
novel therapies for bone-related pathologies.
Author statement
Kai Wang and Zhiping Zhao performed most of the experiments and
wrote the manuscript. Xiangyu Wang assisted with experiments and
data analysis. Yongtao Zhang supervised the project.
Data availability statement
The data that support the findings ofthis study are available from the
corresponding author upon reasonable request.
Declaration of Competing Interest
The authors declare no conflicts of interest.
Acknowledgments
Kai Wang and Zhiping Zhao performed most of the experiments and
wrote the manuscript. Xiangyu Wang assisted with experiments and
data analysis. Yongtao Zhang supervised the project.
References
Alghamdi, S., Khan, I., Beeravolu, N., McKee, C., Thibodeau, B., Wilson, G.,
Chaudhry, G., 2016. BET protein inhibitor JQ1 inhibits growth and modulates WNT
signaling in mesenchymal stem cells. Stem Cell Res. Ther. 7, 22.
Baud’huin, M., Lamoureux, F., Jacques, C., Rodriguez Calleja, L., Quillard, T.,
Charrier, C., Amiaud, J., Berreur, M., Brounais-LeRoyer, B., Owen, R., Reilly, G.,
Bradner, J., Heymann, D., Ory, B., 2017. Inhibition of BET proteins and epigenetic
signaling as a potential treatment for osteoporosis. Bone 94, 10–21.
Chen, X., Shen, Y., He, M., Yang, F., Yang, P., Pang, F., He, W., Cao, Y., Wei, Q., 2019.
Polydatin promotes the osteogenic differentiation of human bone mesenchymal stem
cells by activating the BMP2-Wnt/β-catenin signaling pathway. Biomed.
Pharmacother. 112, 108746.
Chen, C., Jiang, Z., Yang, G., 2020. Laminins in osteogenic differentiation and
pluripotency maintenance. Differentiation 114, 13–19.
Fig. 5. IWP-2 significantly impacted BRD4-induced osteogenic differentiation of BMSCs. BMSCs were infected with AdGFP, AdBRD4 or pretreated with IWP-2 (5
μM). A Representative images of ALP staining on day 7 of osteogenic differentiation (magnifification x 40). B ALP activity on days 3 and 6 of osteogenic differ￾entiation. C Representative images of alizarin red staining on day 14 of osteogenic differentiation (magnifification x 40). D Mineralization quantitated from stained
mineral deposits. E mRNA expression levels of osteogenic genes on day 5 of osteogenic differentiation. Data are representative images or expressed as the mean ± SD
(n = 3 wells/treatment); **p < 0.01 vs. the AdGFP group; ##p < 0.01 vs. the AdBRD4 group.
K. Wang et al.
Tissue and Cell 72 (2021) 101555
Deepak, V., Wang, B., Koot, D., Kasonga, A., Stander, X., Coetzee, M., Stander, A., 2017.
In silico design and bioevaluation of selective benzotriazepine BRD4 inhibitors with
potent antiosteoclastogenic activity. Chem. Biol. Drug Des. 90, 97–111.
Guo, N., Zheng, J., Zi, F., Cheng, J., 2019. I-BET151 suppresses osteoclast formation and
inflammatory cytokines secretion by targetting BRD4 in multiple myeloma. Biosci.
Rep. 39.
He, T., Zhou, S., da Costa, L., Yu, J., Kinzler, K., Vogelstein, B., 1998. A simplified system
for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. U.S.A. 95,
2509–2514.
Hu, H., Zhao, C., Zhang, P., Liu, Y., Jiang, Y., Wu, E., Xue, H., Liu, C., Li, Z., 2019. miR-
26b modulates OA induced BMSC osteogenesis through regulating GSK3β/β-catenin
pathway. Exp. Mol. Pathol. 107, 158–164.
Jacques, C., Lavaud, M., Georges, S., Tesfaye, R., Baud’huin, M., Lamoureux, F., Ory, B.,
2020. BET bromodomains’ functions in bone-related pathologies. Epigenomics 12,
127–144.
Liang, D., Yu, Y., Ma, Z., 2020. Novel strategies targeting bromodomain-containing
protein 4 (BRD4) for cancer drug discovery. Eur. J. Med. Chem. 200, 112426.
Lin, X., Patil, S., Gao, Y., Qian, A., 2020. The bone extracellular matrix in bone formation
and regeneration. Front. Pharmacol. 11, 757.
Liu, Y., Zhang, X., Chen, L., Lin, X., Xiong, D., Xu, F., Yuan, L., Liao, E., 2016. Epigenetic
mechanisms of bone regeneration and homeostasis. Prog. Biophys. Mol. Biol. 122,
85–92.
Long, H., Sun, B., Cheng, L., Zhao, S., Zhu, Y., Zhao, R., Zhu, J., 2017. miR-139-5p
represses BMSC osteogenesis via targeting wnt/β-Catenin signaling pathway. DNA
Cell Biol. 36, 715–724.
Lowery, J., Rosen, V., 2018. The BMP pathway and its inhibitors in the skeleton. Physiol.
Rev. 98, 2431–2452.
Luo, Z., Shang, X., Zhang, H., Wang, G., Massey, P., Barton, S., Kevil, C., Dong, Y., 2019.
Notch signaling in osteogenesis, Osteoclastogenesis, and angiogenesis. Am. J. Pathol.
189, 1495–1500.
Maeda, K., Kobayashi, Y., Koide, M., Uehara, S., Okamoto, M., Ishihara, A., Kayama, T.,
Saito, M., Marumo, K., 2019. The regulation of bone metabolism and disorders by
wnt signaling. Int. J. Mol. Sci. 20.
Meier, J., Tallant, C., Fedorov, O., Witwicka, H., Hwang, S., van Stiphout, R., Lambert, J.,
Rogers, C., Yapp, C., Gerstenberger, B., Fedele, V., Savitsky, P., Heidenreich, D.,
Daniels, D., Owen, D., Fish, P., Igoe, N., Bayle, E., Haendler, B., Oppermann, U.,
Buffa, F., Brennan, P., Müller, S., Gingras, A., Odgren, P., Birnbaum, M., Knapp, S.,
2017. Selective targeting of bromodomains of the Bromodomain-PHD fingers family
impairs osteoclast differentiation. ACS Chem. Biol. 12, 2619–2630.
Meng, S., Zhang, L., Tang, Y., Tu, Q., Zheng, L., Yu, L., Murray, D., Cheng, J., Kim, S.,
Zhou, X., Chen, J., 2014. BET inhibitor JQ1 blocks inflammation and bone
destruction. J. Dent. Res. 93, 657–662.
Mostafa, S., Pakvasa, M., Coalson, E., Zhu, A., Alverdy, A., Castillo, H., Fan, J., Li, A.,
Feng, Y., Wu, D., Bishop, E., Du, S., Spezia, M., Li, A., Hagag, O., Deng, A., Liu, W.,
Li, M., Ho, S., Athiviraham, A., Lee, M., Wolf, J., Ameer, G., Luu, H., Haydon, R.,
Strelzow, J., Hynes, K., He, T., Reid, R., 2019. The wonders of BMP9: from
mesenchymal stem cell differentiation, angiogenesis, neurogenesis, tumorigenesis,
and metabolism to regenerative medicine. Genes Dis. 6, 201–223.
Najafova, Z., Tirado-Magallanes, R., Subramaniam, M., Hossan, T., Schmidt, G.,
Nagarajan, S., Baumgart, S., Mishra, V., Bedi, U., Hesse, E., Knapp, S., Hawse, J.,
Johnsen, S., 2017. BRD4 localization to lineage-specific enhancers is associated with
a distinct transcription factor repertoire. Nucleic Acids Res. 45, 127–141.
Paradise, C., Galvan, M., Kubrova, E., Bowden, S., Liu, E., Carstens, M., Thaler, R.,
Stein, G., van Wijnen, A., Dudakovic, A., 2020. The epigenetic reader Brd4 is
required for osteoblast differentiation. J. Cell. Physiol. 235, 5293–5304.
Park, M., Choi, H., An, J., 2019. Taurine activates BMP-2/Wnt3a-Mediated osteoblast
differentiation and mineralization via akt and MAPK signaling. Iran. J. Public Health
48, 1960–1970.
Ren, Y., Zhang, Y., Wang, Z., Wang, C., Zhang, H., Wang, Y., Zhao, Z., 2019. Role of Brd4
in the production of inflammatory cytokines in mouse macrophages treated with
titanium particles. Can. J. Physiol. Pharmacol. 97, 1028–1034.
Shares, B., Busch, M., White, N., Shum, L., Eliseev, R., 2018. Active mitochondria support
osteogenic differentiation by stimulating β-catenin acetylation. J. Biol. Chem. 293,
16019–16027.
Song, H., Shi, L., Xu, Y., Xu, T., Fan, R., Cao, M., Xu, W., Song, J., 2019. BRD4 promotes
the stemness of gastric cancer cells via attenuating miR-216a-3p-mediated inhibition
of Wnt/β-catenin signaling. Eur. J. Pharmacol. 852, 189–197.
Tang, N., Song, W., Luo, J., Luo, X., Chen, J., Sharff, K., Bi, Y., He, B., Huang, J., Zhu, G.,
Su, Y., Jiang, W., Tang, M., He, Y., Wang, Y., Chen, L., Zuo, G., Shen, J., Pan, X.,
Reid, R., Luu, H., Haydon, R., He, T., 2009. BMP-9-induced osteogenic
differentiation of mesenchymal progenitors requires functional canonical Wnt/beta￾catenin signalling. J. Cell. Mol. Med. 13, 2448–2464.
Taniguchi, Y., 2016. The bromodomain and extra-terminal domain (BET) family:
functional anatomy of BET paralogous proteins. Int. J. Mol. Sci. 17.
Wang, Y., Song, W., Jing, S., Yu, J., 2014. [Effect of estrogen deficiency on the
proliferation and osteogenic differentiation potential of mandibular bone marrow
stromal cells]. Zhonghua Kou Qiang Yi Xue Za Zhi 49, 619–624.
Wang, Y., Kou, J., Zhang, H., Wang, C., Li, H., Ren, Y., Zhang, Y., 2018. The renin￾angiotensin system in the synovium promotes periarticular osteopenia in a rat model
of collagen-induced arthritis. Int. Immunopharmacol. 65, 550–558.
Wang, J., Quan, Y., Lv, J., Gong, S., Dong, D., 2020. BRD4 promotes glioma cell stemness
via enhancing miR-142-5p-mediated activation of Wnt/β-catenin signaling. Environ.
Toxicol. 35, 368–376.
Yongtao, Z., Kunzheng, W., Jingjing, Z., Hu, S., Jianqiang, K., Ruiyu, L., Chunsheng, W.,
2014. Glucocorticoids activate the local renin-angiotensin system in bone: possible
mechanism for glucocorticoid-induced osteoporosis. Endocrine 47, 598–608.
Zhang, Y., Wang, K., Song, Q., Liu, R., Ji, W., Ji, L., Wang, C., 2014. Role of the local bone
renin‑angiotensin system in steroid‑induced osteonecrosis in rabbits. Mol. Med. Rep.
9, 1128–1134.
Zhang, H., Wang, J., Deng, F., Huang, E., Yan, Z., Wang, Z., Deng, Y., Zhang, Q.,
Zhang, Z., Ye, J., Qiao, M., Li, R., Wang, J., Wei, Q., Zhou, G., Luu, H., Haydon, R.,
He, T., Deng, F., 2015. Canonical Wnt signaling acts synergistically on BMP9-
induced osteo/odontoblastic differentiation of stem cells of dental apical papilla
(SCAPs). Biomaterials 39, 145–154.
Zhang, B., Yang, L., Zeng, Z., Feng, Y., Wang, X., Wu, X., Luo, H., Zhang, J., Zhang, M.,
Pakvasa, M., Wagstaff, W., He, F., Mao, Y., Qin, K., Ding, H., Zhang, Y., Niu, C.,
Wu, M., Zhao, X., Wang, H., Huang, L., Shi, D., Liu, Q., Ni, N., Fu, K.,
Athiviraham, A., Moriatis Wolf, J., Lee, M., Hynes, K., Strelzow, J., El Dafrawy, M.,
Xia, Y., He, T., 2020a. Leptin potentiates BMP9-Induced osteogenic differentiation of
mesenchymal stem cells through the activation of JAK/STAT signaling. Stem Cells
Dev. 29, 498–510.
Zhang, Y., Ding, H., Song, Q., Wang, Z., Yuan, W., Ren, Y., Zhao, Z., Wang, C., 2020b.
Angiotensin II inhibits osteogenic differentiation of isolated synoviocytes by
increasing DKK-1 expression. Int. J. Biochem. Cell Biol. 121, 105703.
K. Wang et al.